Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17282877

Xenopus ORFeome

ORF Name:m6prbp1-prov ORF1 Species: laevis
Gene Symbol: plin3.S Entrez Gene ID: 446543
Gene Synonyms: m6prbp1, pp17, tip47
Gene Name: perilipin 3
Description:
Plate: GDExl11035 Well: G05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ826768
3' ORF Sequence: JZ826767
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis mannose-6-phosphate receptor binding protein 1, mRNA (cDNA clone MGC:80328 IMAGE:5074017), complete cds
Template Accession: BC077335
GI: 50417471
Clone ID: MGC:80328 IMAGE:5074017
Tissue: ovary
Stage: frog
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGAGGATGGAACTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACCCTTTCATTGGCTGCTCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556