Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17282895

Xenopus ORFeome

ORF Name:mab21l2 ORF2 Species: laevis
Gene Symbol: mab21l2.L Entrez Gene ID: 399091
Gene Synonyms: mab21l2-a, mab21l2-b, xmab-21, xmab21, xmab21l2
Gene Name: mab-21-like 2
Description: Mab-21-like cell fate specification proteins
Plate: GDExl11059 Well: E08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ833093
3' ORF Sequence: JZ833094
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis XMAB21, mRNA (cDNA clone MGC:84442 IMAGE:7019721), complete cds
Template Accession: BC074421
GI: 49257875
Clone ID: MGC:84442 IMAGE:7019721
Tissue: eye
Stage: frog
Clone Library: NICHD_XGC_Eye1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATCGCGGCCCAGGCCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGCTTGTCGAGGCTTTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556