Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17282943

Xenopus ORFeome
What is the ORFeome?

ORF Name:maff.S ORF1 Species: laevis
Gene Symbol: maff.S Entrez Gene ID: 495449
Gene Synonyms:
Gene Name: v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog F
Description: basic-leucine zipper (bZIP) transcription factor
Plate: GDExl11075 Well: H04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ835821
3' ORF Sequence: JZ835822
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC495449, mRNA (cDNA clone MGC:84297 IMAGE:6957056), complete cds
Template Accession: BC084971
GI: 54647611
Clone ID: IMAGE:6957056
Tissue: eye
Stage:
Clone Library: NICHD_XGC_Eye1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTTCAGACGGAATGTCGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGTAGGAGTTTCCAGAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556