Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17282949

Xenopus ORFeome
What is the ORFeome?

ORF Name:magoh.L ORF1 Species: laevis
Gene Symbol: magoh.L Entrez Gene ID: 379411
Gene Synonyms: grandchildless, mago, mago nashi, xl-mago
Gene Name: mago homolog, exon junction complex subunit
Description: exon-exon junction complex component
Plate: GDExl11001 Well: E11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ839219
3' ORF Sequence: JZ839218
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis mago-nashi homolog, mRNA (cDNA clone MGC:64274 IMAGE:6873436), complete cds
Template Accession: BC053764
GI: 32450348
Clone ID: IMAGE:6873436
Tissue: whole organism
Stage: NF stage 62
Clone Library: NICHD_XGC_Tad2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAGCGATTTCTATCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATGGGCTTAATTTTGAAGTGAAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers