Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17283123

Xenopus ORFeome
What is the ORFeome?

ORF Name:mapk1.S ORF1 Species: laevis
Gene Symbol: mapk1.S Entrez Gene ID: 398985
Gene Synonyms: erk, erk2, ert1, map kinase, mapk, mapk1-a, mapk1-b, mapk2, mpk1, p42mapk, prkm1, prkm2, xp42
Gene Name: mitogen-activated protein kinase 1
Description: serine/threonine kinase
Plate: GDExl11023 Well: G10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824962
3' ORF Sequence: JZ830328
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MAP kinase, mRNA (cDNA clone MGC:68934 IMAGE:4957750), complete cds
Template Accession: BC060748
GI: 38173756
Clone ID: IMAGE:4957750
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCGGCAGGAGC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTACCCTGGCTGGAATCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers