Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17283363

Xenopus ORFeome
What is the ORFeome?

ORF Name:mbtd1.L ORF1 Species: laevis
Gene Symbol: mbtd1.L Entrez Gene ID: 443638
Gene Synonyms:
Gene Name: mbt domain containing 1
Description: Polycomb group protein SCM/L(3)MBT (tumor-supressor in Drosophila and humans)
Plate: GDExl11078 Well: G01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ836450
3' ORF Sequence: JZ836451
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein LOC443638, mRNA (cDNA clone MGC:132084 IMAGE:5079710), complete cds
Template Accession: BC108771
GI: 80478587
Clone ID: IMAGE:5079710
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAAAGACCAAGGATCCG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGGCCTGTTACCAGGCTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers