Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17283735

Xenopus ORFeome
What is the ORFeome?

ORF Name:meis3.S ORF1 Species: laevis
Gene Symbol: meis3.S Entrez Gene ID: 379219
Gene Synonyms: meis3-a, meis3-b, mrg2, xmeis3
Gene Name: Meis homeobox 3
Description: homeodomain transcription factor
Plate: GDExl11016 Well: E03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824300
3' ORF Sequence: JZ829648
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Homeobox protein meis3-B, mRNA (cDNA clone MGC:52546 IMAGE:5571486), complete cds
Template Accession: BC044024
GI: 27881707
Clone ID: IMAGE:5571486
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACAAAGGTATGACGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGAGCGTGAATGTCTATGTTTTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556