Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17284173

Xenopus ORFeome
What is the ORFeome?

ORF Name:mis12.L ORF1 Species: laevis
Gene Symbol: mis12.L Entrez Gene ID: 444231
Gene Synonyms: kntc2ap, mtw1
Gene Name: MIS12 kinetochore complex component
Description:
Plate: GDExl11038 Well: B10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ827409
3' ORF Sequence: JZ827408
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: bad
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC80789 protein, mRNA (cDNA clone MGC:80789 IMAGE:5513400), complete cds
Template Accession: BC073368
GI: 49118370
Clone ID: IMAGE:5513400
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGCTATGAAAGTCAGCTGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCCCTTTTCTATTTCGAGGACA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers