Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17285289

Xenopus ORFeome
What is the ORFeome?

ORF Name:mycn.S ORF1 Species: laevis
Gene Symbol: mycn.S Entrez Gene ID: 380041
Gene Synonyms: mycn-a, mycn-b, n-myc, xn-myc, xn-myc1, xnmyc
Gene Name: MYCN proto-oncogene, bHLH transcription factor
Description: basic helix-loop-helix transcription factor, partners with max proteins
Plate: GDExl11010 Well: A06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ823852
3' ORF Sequence: JZ829160
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), mRNA (cDNA clone MGC:52873 IMAGE:4888626), complete cds
Template Accession: BC043747
GI: 27695120
Clone ID: IMAGE:4888626
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCAGGGTTGGTGAGCAGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAAGTCCGCAAGCGTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers