Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17285493

Xenopus ORFeome

ORF Name:n4bp1 ORF1 Species: laevis
Gene Symbol: n4bp1.L Entrez Gene ID: 380566
Gene Synonyms:
Gene Name: nedd4 binding protein 1
Description: Uncharacterized conserved protein
Plate: GDExl11012 Well: F09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ824005
3' ORF Sequence: JZ829313
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Nedd4 binding protein 1, mRNA (cDNA clone MGC:53091 IMAGE:5542244), complete cds
Template Accession: BC045006
GI: 27924423
Clone ID: MGC:53091 IMAGE:5542244
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTACGGGTTCCGTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCGAGCACCATTGCTGAC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556