Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17285499

Xenopus ORFeome

ORF Name:n6amt1 ORF1 Species: laevis
Gene Symbol: n6amt1.L Entrez Gene ID: 734608
Gene Synonyms:
Gene Name: N-6 adenine-specific DNA methyltransferase 1
Description: Predicted N6-DNA-methyltransferase
Plate: GDExl11081 Well: D07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ837033
3' ORF Sequence: JZ837032
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: mixed
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC115637, mRNA (cDNA clone MGC:115637 IMAGE:3748423), complete cds
Template Accession: BC097870
GI: 66911093
Clone ID: MGC:115637 IMAGE:3748423
Tissue: whole organism
Stage: NF stage 10.5 to NF stage 11.5
Clone Library: Xenopus laevis gastrula non normalized
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGCCCACACCGGTA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGTGCTTTCAACAATTTCTTGAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556