Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17285601

Xenopus ORFeome
What is the ORFeome?

ORF Name:naif1.S ORF1 Species: laevis
Gene Symbol: naif1.S Entrez Gene ID: 779282
Gene Synonyms:
Gene Name: nuclear apoptosis inducing factor 1
Description: SNARE protein PEP12/VAM3/Syntaxin 7/Syntaxin 17
Plate: GDExl11091 Well: F11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ838845
3' ORF Sequence: JZ838844
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC154511, mRNA (cDNA clone MGC:154511 IMAGE:8319515), complete cds
Template Accession: BC123252
GI: 114108302
Clone ID: IMAGE:8319515
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTACGCCAGCCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGATTTATACTATCTGATTGTCC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1


Major funding for Xenbase is provided by grant P41 HD064556