Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17285703

Xenopus ORFeome
What is the ORFeome?

ORF Name:ncam1.S ORF1 Species: laevis
Gene Symbol: ncam1.S Entrez Gene ID: 397761
Gene Synonyms: n-cam, n-cam-1, ncam, ncam1-a, ncam1-b
Gene Name: neural cell adhesion molecule 1
Description: cell adhesion
Plate: GDExl11058 Well: E06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ832796
3' ORF Sequence: JZ832797
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis neural cell adhesion molecule, mRNA (cDNA clone MGC:84369 IMAGE:6959013), complete cds
Template Accession: BC081181
GI: 51703937
Clone ID: IMAGE:6959013
Tissue: eye
Stage:
Clone Library: NICHD_XGC_Eye1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGCACATTAAGGATCTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACAAGGAACAATGGCAATTACTAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1


Major funding for Xenbase is provided by grant P41 HD064556