Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17286147

Xenopus ORFeome
What is the ORFeome?

ORF Name:nell2.L ORF1 Species: laevis
Gene Symbol: nell2.L Entrez Gene ID: 380051
Gene Synonyms: mgc53340
Gene Name: neural EGFL like 2
Description: cytoplasmic protein with epidermal growth factor-like repeats
Plate: GDExl11015 Well: E04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824221
3' ORF Sequence: JZ829535
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis NEL-like 2 (chicken), mRNA (cDNA clone MGC:53340 IMAGE:5570961), complete cds
Template Accession: BC044701
GI: 27881742
Clone ID: IMAGE:5570961
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTTTATATTGGGCATATTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGCTCCTGAAGGCACT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers