Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17286201

Xenopus ORFeome
What is the ORFeome?

ORF Name:nfe2l2.S ORF1 Species: laevis
Gene Symbol: nfe2l2.S Entrez Gene ID: 444736
Gene Synonyms: nf-e2, nf-e2r2
Gene Name: nuclear factor, erythroid 2 like 2
Description: basic-leucine zipper (bZIP) transcription factor
Plate: GDExl11057 Well: G07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ832651
3' ORF Sequence: JZ832652
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC84750 protein, mRNA (cDNA clone MGC:84750 IMAGE:6949882), complete cds
Template Accession: BC074462
GI: 49256362
Clone ID: IMAGE:6949882
Tissue: brain
Stage:
Clone Library: NICHD_XGC_Brn1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGGAGATCGAGATACCCCTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCTTCTTTATGCTAACTTTCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556