Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17286213

Xenopus ORFeome
What is the ORFeome?

ORF Name:nfkb1.L ORF1 Species: laevis
Gene Symbol: nfkb1.L Entrez Gene ID: 447632
Gene Synonyms: ebp-1, kbf1, nf-kappa-b, nf-kappab, nfkb-p105, nfkb-p50
Gene Name: nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
Description: transcriptional regulator
Plate: GDExl11076 Well: E02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ835997
3' ORF Sequence: JZ835998
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: low
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC86262 protein, mRNA (cDNA clone MGC:86262 IMAGE:7018790), complete cds
Template Accession: BC081252
GI: 51703614
Clone ID: IMAGE:7018790
Tissue: brain
Stage:
Clone Library: NICHD_XGC_Brn1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACAAAACATGTATGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTGCTGCAGATGAGAGGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers