Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17286453

Xenopus ORFeome
What is the ORFeome?

ORF Name:nlgn3.S ORF1 Species: laevis
Gene Symbol: nlgn3.S Entrez Gene ID: 447240
Gene Synonyms: hnl3
Gene Name: neuroligin 3
Description: Acetylcholinesterase/Butyrylcholinesterase
Plate: GDExl11060 Well: B01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ833079
3' ORF Sequence: JZ833080
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC84475 protein, mRNA (cDNA clone MGC:84475 IMAGE:7020561), complete cds
Template Accession: BC079746
GI: 50925138
Clone ID: IMAGE:7020561
Tissue: eye
Stage:
Clone Library: NICHD_XGC_Eye1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTATGGGGTTGGGCTGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATACTCTAGTGGTGGAGTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers