Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17286591

Xenopus ORFeome
What is the ORFeome?

ORF Name:nol11.S ORF1 Species: laevis
Gene Symbol: nol11.S Entrez Gene ID: 432185
Gene Synonyms:
Gene Name: nucleolar protein 11
Description:
Plate: GDExl11085 Well: F02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ837711
3' ORF Sequence: JZ837710
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Nucleolar protein 11, mRNA (cDNA clone MGC:132088 IMAGE:6861674), complete cds
Template Accession: BC108774
GI: 83318343
Clone ID: IMAGE:6861674
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGCTCTCAGTGAGCACTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAGAGTTGGAGCACTTCTAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers