Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17286663

Xenopus ORFeome
What is the ORFeome?

ORF Name:not.S ORF1 Species: laevis
Gene Symbol: not.S Entrez Gene ID: 397961
Gene Synonyms: flh, floating head, not-a, not-b, not1, noto, xnot, xnot-2, xnot1, xnot2, znot
Gene Name: notochord homeobox
Description: homeodomain transcription factor
Plate: GDExl11088 Well: D09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ838249
3' ORF Sequence: JZ838248
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: bad
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis cDNA clone MGC:154485 IMAGE:8318484, complete cds
Template Accession: BC123237
GI: 114108094
Clone ID: IMAGE:8318484
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTTGCCCAGGACCCCAAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGTTCCACATCCAGATCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556