Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17286669

Xenopus ORFeome
What is the ORFeome?

ORF Name:not.L ORF1 Species: laevis
Gene Symbol: not.L Entrez Gene ID: 397703
Gene Synonyms: flh, floating head, not-a, not-b, not1, noto, xnot, xnot-2, xnot1, xnot2, znot
Gene Name: notochord homeobox
Description: homeodomain transcription factor
Plate: GDExl11091 Well: B10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ838746
3' ORF Sequence: JZ838745
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: bad
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis homeobox protein, mRNA (cDNA clone MGC:154555 IMAGE:8322189), complete cds
Template Accession: BC123277
GI: 114107919
Clone ID: IMAGE:8322189
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCCTCGCCACGGACT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGTTCCACATCTACATCATC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556