Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17286855

Xenopus ORFeome
What is the ORFeome?

ORF Name:nr3c1.L ORF1 Species: laevis
Gene Symbol: nr3c1.L Entrez Gene ID: 397897
Gene Synonyms: gccr, gcr, glucocorticoid receptor, grl, nr3c1-a, nr3c1-b, xgr
Gene Name: nuclear receptor subfamily 3 group C member 1
Description: steroid hormone receptor
Plate: GDExl11052 Well: D06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ831765
3' ORF Sequence: JZ831766
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis glucocorticoid receptor protein, mRNA (cDNA clone MGC:83461 IMAGE:3404796), complete cds
Template Accession: BC077547
GI: 50417551
Clone ID: IMAGE:3404796
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACCCCAAAGACCTTTTA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTTGATGAAATAACAGTTTTTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556