Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17287059

Xenopus ORFeome
What is the ORFeome?

ORF Name:ntf3.S ORF1 Species: laevis
Gene Symbol: ntf3.S Entrez Gene ID: 444638
Gene Synonyms: hdnf, neurotrophin-3, ngf-2, ngf2, nt-3, nt3
Gene Name: neurotrophin 3
Description: growth factor
Plate: GDExl11058 Well: F04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ832667
3' ORF Sequence: JZ832668
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: bad
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC84157 protein, mRNA (cDNA clone MGC:84157 IMAGE:6952060), complete cds
Template Accession: BC074327
GI: 49256266
Clone ID: IMAGE:6952060
Tissue: brain
Stage:
Clone Library: NICHD_XGC_Brn1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCATCCTGTTTTGTGTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGATCTTCCTATTTTCCTTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556