Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17287089

Xenopus ORFeome
What is the ORFeome?

ORF Name:ntrk2.L ORF1 Species: laevis
Gene Symbol: ntrk2.L Entrez Gene ID: 379266
Gene Synonyms: ntrk2-a, ntrk2-b, trkb, xtrkb
Gene Name: neurotrophic receptor tyrosine kinase 2
Description: nerve growth factor receptor
Plate: GDExl11010 Well: D09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ823812
3' ORF Sequence: JZ829122
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis neurotrophin receptor B xTrkB-alpha, mRNA (cDNA clone MGC:52547 IMAGE:4930174), complete cds
Template Accession: BC044959
GI: 27924169
Clone ID: IMAGE:4930174
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCGCCTCTGGAAAGGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACCCATTCAGAGGAACCGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556