Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17287377

Xenopus ORFeome

ORF Name:oaz1 ORF1 Species: laevis
Gene Symbol: oaz1.S Entrez Gene ID: 379737
Gene Synonyms: odc-az
Gene Name: ornithine decarboxylase antizyme 1
Description: enzyme inhibitor
Plate: GDExl11018 Well: C04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ824442
3' ORF Sequence: JZ829798
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis ornithine decarboxylase antizyme, mRNA (cDNA clone MGC:68610 IMAGE:4032028), complete cds
Template Accession: BC059788
GI: 37590507
Clone ID: MGC:68610 IMAGE:4032028
Tissue: mesonephric kidney
Stage: frog
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCAAGTGGTTCTCTACCTGAT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCTTCATCAGAAGAATCTCTTTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556