Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17287407

Xenopus ORFeome

ORF Name:odf2 ORF1 Species: laevis
Gene Symbol: odf2.L Entrez Gene ID: 496006
Gene Synonyms:
Gene Name: outer dense fiber of sperm tails 2
Description: myosin ATPase
Plate: GDExl11061 Well: B06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ833270
3' ORF Sequence: JZ833271
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC496006, mRNA (cDNA clone MGC:99177 IMAGE:7206882), complete cds
Template Accession: BC087396
GI: 56269976
Clone ID: MGC:99177 IMAGE:7206882
Tissue: testis
Stage: frog
Clone Library: NICHD_XGC_Te2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAAAACCGCTCTCCCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGGCACAGTTGCGCCAAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556