Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17287701

Xenopus ORFeome
What is the ORFeome?

ORF Name:otx2.S ORF1 Species: laevis
Gene Symbol: otx2.S Entrez Gene ID: 399342
Gene Synonyms: otx-2, otx2-a, otx2-b, otxa, xotx-2, xotx2
Gene Name: orthodenticle homeobox 2
Description: homeodomain transcription factor
Plate: GDExl11045 Well: G09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ830828
3' ORF Sequence: JZ830829
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis homeobox protein, mRNA (cDNA clone MGC:81325 IMAGE:6632834), complete cds
Template Accession: BC077357
GI: 50417481
Clone ID: IMAGE:6632834
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGTCTTATCTCAAGCAACC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAAACCTGGAATTTCCAAGATG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556