Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17287779

Xenopus ORFeome

ORF Name:p4hb ORF1 Species: laevis
Gene Symbol: p4hb.L Entrez Gene ID: 399248
Gene Synonyms:
Gene Name: prolyl 4-hydroxylase subunit beta
Description: collagen synthesis, enzyme subunit
Plate: GDExl11033 Well: H03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ826423
3' ORF Sequence: JZ826422
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis similar to procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide (protein disulfide isomerase; thyroid hormone binding protein p55), mRNA (cDNA clone MGC:80092 IMAGE:4962804), complete cds
Template Accession: BC077772
GI: 50414763
Clone ID: MGC:80092 IMAGE:4962804
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGCGTGCTGTTCTTCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATAATTCATCTTTTGTATGGATGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556