Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17287791

Xenopus ORFeome

ORF Name:paaf1 ORF1 Species: laevis
Gene Symbol: paaf1.S Entrez Gene ID: 398057
Gene Synonyms: paaf, rpn14, wdr71
Gene Name: proteasomal ATPase associated factor 1
Description: WD40 repeat-containing protein
Plate: GDExl11060 Well: C06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ833339
3' ORF Sequence: JZ833340
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis cDNA clone MGC:99093 IMAGE:7204433, complete cds
Template Accession: BC088671
GI: 56970889
Clone ID: Xenopus laevis cDNA clone MGC:99093 IMAGE:7204433, complete cds
Tissue: testis
Stage: frog
Clone Library: NICHD_XGC_Te2N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCCATGCTCTCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCCAGATCTGGGATTTCATATT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556