Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17288127

Xenopus ORFeome
What is the ORFeome?

ORF Name:pax2.L ORF1 Species: laevis
Gene Symbol: pax2.L Entrez Gene ID: 379520
Gene Synonyms: pax-2, pax2-a, pax2-b, xpax-2, xpax2
Gene Name: paired box 2
Description: paired box transcription factor
Plate: GDExl11021 Well: B01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824672
3' ORF Sequence: JZ830024
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis paired box protein, mRNA (cDNA clone MGC:68430 IMAGE:5571307), complete cds
Template Accession: BC055960
GI: 33585946
Clone ID: IMAGE:5571307
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATATGCACTGCAAGGCAGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGCGGTCATAGGCAGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556