Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17288133

Xenopus ORFeome
What is the ORFeome?

ORF Name:pax2.L ORF2 Species: laevis
Gene Symbol: pax2.L Entrez Gene ID: 108697493
Gene Synonyms: pax-2, pax2-a, pax2-b, xpax-2, xpax2
Gene Name: paired box 2
Description: paired box transcription factor
Plate: GDExl11034 Well: E12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ826697
3' ORF Sequence: No sequence available
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis cDNA clone MGC:82453 IMAGE:4889086, complete cds
Template Accession: BC077463
GI: 50604080
Clone ID: IMAGE:4889086
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATATGCACTGCAAGGCAGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGCGGTCATAGGCAGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556