Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17288139

Xenopus ORFeome
What is the ORFeome?

ORF Name:pax3.S ORF1 Species: laevis
Gene Symbol: pax3.S Entrez Gene ID: 496376
Gene Synonyms: cdhs, hup2, pax-3, pax3-a, pax3-b, waardenburg syndrome 1, ws1, xpax3
Gene Name: paired box 3
Description: paired box transcription factor with homeodomain
Plate: GDExl11067 Well: B10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ834418
3' ORF Sequence: JZ834419
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis paired-box 3, mRNA (cDNA clone MGC:131061 IMAGE:7981250), complete cds
Template Accession: BC108573
GI: 80479305
Clone ID: pax3-863
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCAGCTTGGCTGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCAATATCTGGCTTCAGATAATG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556