Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17288193

Xenopus ORFeome
What is the ORFeome?

ORF Name:pc.1.L ORF1 Species: laevis
Gene Symbol: pc.1.L Entrez Gene ID: 398811
Gene Synonyms: mgc68971, pcb, pyruvate carboxylase
Gene Name: pyruvate carboxylase, gene 1
Description: Pyruvate carboxylase
Plate: GDExl11019 Well: G11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824647
3' ORF Sequence: JZ829998
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis pyruvate carboxylase, mRNA (cDNA clone MGC:68971 IMAGE:4959862), complete cds
Template Accession: BC059308
GI: 37748212
Clone ID: IMAGE:4959862
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGCAGCTCCGTTTTGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCAATTTCCAGTAAAAGGTCTTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers