Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17288283

Xenopus ORFeome
What is the ORFeome?

ORF Name:pcif1.S ORF1 Species: laevis
Gene Symbol: pcif1.S Entrez Gene ID: 734251
Gene Synonyms: ppp1r121
Gene Name: phosphorylated CTD interacting factor 1
Description:
Plate: GDExl11079 Well: D11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ836656
3' ORF Sequence: JZ836657
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC85084, mRNA (cDNA clone MGC:85084 IMAGE:6867322), complete cds
Template Accession: BC089119
GI: 57921023
Clone ID: IMAGE:6867322
Tissue: egg
Stage: unfertilized egg stage
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCGTGACAATCATGGAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTTGCCGTGCTGTCCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers