Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17288577

Xenopus ORFeome
What is the ORFeome?

ORF Name:pdia5.L ORF1 Species: laevis
Gene Symbol: pdia5.L Entrez Gene ID: 446435
Gene Synonyms: pdir
Gene Name: protein disulfide isomerase family A member 5
Description:
Plate: GDExl11055 Well: C05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ832107
3' ORF Sequence: JZ832108
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC84594 protein, mRNA (cDNA clone MGC:84594 IMAGE:6640307), complete cds
Template Accession: BC076861
GI: 49899129
Clone ID: IMAGE:6640307
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCCTGCCGGGCG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAATTCATCCTTTTTCTTGCCC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers