Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17288931

Xenopus ORFeome
What is the ORFeome?

ORF Name:pglyrp1.L ORF1 Species: laevis
Gene Symbol: pglyrp1.S Entrez Gene ID: 496035
Gene Synonyms: mgc108469, pgrp-s
Gene Name: peptidoglycan recognition protein 1
Description:
Plate: GDExl11062 Well: G11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ833555
3' ORF Sequence: JZ833556
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC496035, mRNA (cDNA clone MGC:99236 IMAGE:7209646), complete cds
Template Accession: BC087429
GI: 56269180
Clone ID: IMAGE:7209646
Tissue: testis
Stage:
Clone Library: NICHD_XGC_Te2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGCGACTTCTTGCATT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCTTGGAAACGGGGCCAAGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers