Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17289843

Xenopus ORFeome
What is the ORFeome?

ORF Name:pold1.L ORF1 Species: laevis
Gene Symbol: pold1.L Entrez Gene ID: 447518
Gene Synonyms: cdc2, pold
Gene Name: polymerase (DNA directed), delta 1, catalytic subunit
Description: DNA polymerase delta, catalytic subunit
Plate: GDExl11044 Well: C11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ830701
3' ORF Sequence: JZ830702
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis polymerase (DNA directed), delta 1, catalytic subunit, mRNA (cDNA clone MGC:83185 IMAGE:6632249), complete cds
Template Accession: BC081093
GI: 51895813
Clone ID: IMAGE:6632249
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATTTCAAAAGAAAGAAAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACCAAGCTGGGGGTCCAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers