Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17290083

Xenopus ORFeome
What is the ORFeome?

ORF Name:pou5f3.3.L ORF1 Species: laevis
Gene Symbol: pou5f3.3.L Entrez Gene ID: 397936
Gene Synonyms: oct-60, oct60, pou60, xlpou-60, xlpou60, xoct60
Gene Name: POU class 5 homeobox 3, gene 3
Description: Transcription factor OCT-1, contains POU and HOX domains
Plate: GDExl11024 Well: C06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825047
3' ORF Sequence: JZ830411
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis POU-domain protein, mRNA (cDNA clone MGC:79964 IMAGE:4032173), complete cds
Template Accession: BC070557
GI: 47123924
Clone ID: IMAGE:4032173
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACCAGCCCATATTGTA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCGGTCAGGACCCCCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556