Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17290299

Xenopus ORFeome
What is the ORFeome?

ORF Name:ppme1.S ORF1 Species: laevis
Gene Symbol: ppme1.S Entrez Gene ID: 446717
Gene Synonyms:
Gene Name: protein phosphatase methylesterase 1
Description: Predicted acetyltransferases and hydrolases with the alpha/beta hydrolase fold
Plate: GDExl11052 Well: E01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ831847
3' ORF Sequence: JZ831848
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC84506 protein, mRNA (cDNA clone MGC:84506 IMAGE:4757615), complete cds
Template Accession: BC077600
GI: 50418398
Clone ID: IMAGE:4757615
Tissue: eye
Stage:
Clone Library: NICHD_XGC_Eye1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGCCTTGGAAAAGCATC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACAGGCGGGGAACACACA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556