Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17290311

Xenopus ORFeome
What is the ORFeome?

ORF Name:ppp1ca.L ORF1 Species: laevis
Gene Symbol: ppp1ca.L Entrez Gene ID: 379914
Gene Synonyms: ppp1a
Gene Name: protein phosphatase 1, catalytic subunit, alpha isozyme
Description: serine/threonine specific protein phosphatase subunit
Plate: GDExl11008 Well: E06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ823666
3' ORF Sequence: JZ828976
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Protein phosphatase type 1 alpha, catalytic subunit, mRNA (cDNA clone MGC:52704 IMAGE:4682749), complete cds
Template Accession: BC041730
GI: 27695193
Clone ID: IMAGE:4682749
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGGACGGAGAAAAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGGACTGTTTGTTTTTGTTCCG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers