Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17290467

Xenopus ORFeome
What is the ORFeome?

ORF Name:ppp2r1a.L ORF1 Species: laevis
Gene Symbol: ppp2r1a.L Entrez Gene ID: 379827
Gene Synonyms: pp2a-aalpha, pp2aaalpha, ppp2r1a-a, ppp2r1a-b, pr65a
Gene Name: protein phosphatase 2 regulatory subunit A, alpha
Description: Protein phosphatase 2A regulatory subunit A and related proteins
Plate: GDExl11011 Well: H05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ823900
3' ORF Sequence: JZ829209
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform, mRNA (cDNA clone MGC:53746 IMAGE:4930712), complete cds
Template Accession: BC046723
GI: 28436859
Clone ID: IMAGE:4930712
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGGCAGACGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCCAAAGCCAGCACTGTAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556