Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17290563

Xenopus ORFeome
What is the ORFeome?

ORF Name:ppp4r2.S ORF1 Species: laevis
Gene Symbol: ppp4r2.S Entrez Gene ID: 446890
Gene Synonyms: pp4r2, ppp4r2-a, ppp4r2-b
Gene Name: protein phosphatase 4 regulatory subunit 2
Description:
Plate: GDExl11040 Well: C12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ827885
3' ORF Sequence: JZ827884
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis protein phosphatase 4, regulatory subunit 2, mRNA (cDNA clone MGC:80935 IMAGE:5516112), complete cds
Template Accession: BC077952
GI: 50418288
Clone ID: IMAGE:5516112
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACGTCGACCGGCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCTTGTTCCATAGGTTCCTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556