Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17290683

Xenopus ORFeome
What is the ORFeome?

ORF Name:prdx1.S ORF2 Species: laevis
Gene Symbol: prdx1.S Entrez Gene ID: 443911
Gene Synonyms: msp23, nkefa, pag, paga, pagb, peroxiredoxin 1, prxi, prxi-1, tdpx2
Gene Name: peroxiredoxin 1
Description: antioxidant enzyme
Plate: GDExl11057 Well: G11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ832745
3' ORF Sequence: JZ832746
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC80194 protein, mRNA (cDNA clone MGC:84820 IMAGE:6954989), complete cds
Template Accession: BC082483
GI: 52078465
Clone ID: IMAGE:6954989
Tissue: brain
Stage:
Clone Library: NICHD_XGC_Brn1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGTCGGAAATGCAAAAATT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTGCTTGCTGAAGTACTCTTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556