Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17290743

Xenopus ORFeome
What is the ORFeome?

ORF Name:prepl.S ORF1 Species: laevis
Gene Symbol: prepl.L Entrez Gene ID: 100381109
Gene Synonyms: prepl-a, prepl-b
Gene Name: prolyl endopeptidase-like
Description: Predicted serine protease
Plate: GDExl11082 Well: D12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ837265
3' ORF Sequence: JZ837264
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis cDNA clone MGC:132259 IMAGE:5073580, complete cds
Template Accession: BC108840
GI: 80477834
Clone ID: IMAGE:5073580
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGAGGAATTTAGCTCAGCA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGAGTCGAGCCTTTGCAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556