Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17290761

Xenopus ORFeome
What is the ORFeome?

ORF Name:prickle1.L ORF1 Species: laevis
Gene Symbol: prickle1.L Entrez Gene ID: 398264
Gene Synonyms: prickle, prickle a, prickle b, prickle-b, prickle1-a, prickle1-b, xpk, xpk-1
Gene Name: prickle planar cell polarity protein 1
Description: nuclear receptor, may be a negative regulator of the Wnt/beta-catenin signaling pathway [Entrez]
Plate: GDExl11037 Well: H06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ827183
3' ORF Sequence: JZ827182
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: unknown
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis LIM protein prickle b, mRNA (cDNA clone MGC:80487 IMAGE:5156646), complete cds
Template Accession: BC073208
GI: 49115155
Clone ID: IMAGE:5156646
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGCCCAGGACATCTGAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAAATAATGCAGTTTTTGCCTTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556