Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17290893

Xenopus ORFeome
What is the ORFeome?

ORF Name:prmt1.L ORF1 Species: laevis
Gene Symbol: prmt1.L Entrez Gene ID: 398716
Gene Synonyms: 3e10, anm1, hcp1, hrmt1l2, ir1b4, prmt1-a, prmt1-b, xprmt1, xprmt1, xprmt1b
Gene Name: protein arginine methyltransferase 1
Description: methyltransferase
Plate: GDExl11031 Well: H06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ826048
3' ORF Sequence: No sequence available
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: low
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis arginine methyltransferase 1b, mRNA (cDNA clone MGC:78956 IMAGE:4404608), complete cds
Template Accession: BC072069
GI: 47937502
Clone ID: IMAGE:4404608
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGTTTCTTGTGCTCTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGCATTCTATAGTCTGTCGAAC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers