Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17290917

Xenopus ORFeome
What is the ORFeome?

ORF Name:prmt5.L ORF1 Species: laevis
Gene Symbol: prmt5.L Entrez Gene ID: 495515
Gene Synonyms: hsl7
Gene Name: protein arginine methyltransferase 5
Description: protein kinase inhibitor
Plate: GDExl11085 Well: A07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: No sequence available
3' ORF Sequence: JZ837665
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC495515, mRNA (cDNA clone MGC:132054 IMAGE:6957633), complete cds
Template Accession: BC108761
GI: 83318409
Clone ID: IMAGE:6957633
Tissue: eye
Stage:
Clone Library: NICHD_XGC_Eye1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCAGGCGGTGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGCCAATTGTGTAAGAAC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers