Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17291049

Xenopus ORFeome
What is the ORFeome?

ORF Name:prph2.L ORF1 Species: laevis
Gene Symbol: prph2.L Entrez Gene ID: 379506
Gene Synonyms: aofmd, avmd, cacd2, peripherin 2, rds, rds38, tspan22
Gene Name: peripherin 2 (retinal degeneration, slow)
Description: Tetraspanin family integral membrane protein
Plate: GDExl11002 Well: F07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ839279
3' ORF Sequence: JZ839278
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC64379, mRNA (cDNA clone MGC:64379 IMAGE:6878380), complete cds
Template Accession: BC054965
GI: 32766468
Clone ID: IMAGE:6878380
Tissue: whole organism
Stage: NF stage 54 to prometamorphosis stage
Clone Library: NICHD_XGC_Tad1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCCTGATGAAAACAAAATTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGACAGTTGCTACTCCTGCTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.0


Major funding for Xenbase is provided by grant P41 HD064556