Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17291121

Xenopus ORFeome
What is the ORFeome?

ORF Name:prrg4.L ORF1 Species: laevis
Gene Symbol: prrg2.L Entrez Gene ID: 735051
Gene Synonyms: prgp4, prrg4, tmg4
Gene Name: proline rich Gla (G-carboxyglutamic acid) 2 (transmembrane)
Description: Trypsin
Plate: GDExl11079 Well: F10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ836698
3' ORF Sequence: JZ836699
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: mixed
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC85050, mRNA (cDNA clone MGC:85050 IMAGE:6326933), complete cds
Template Accession: BC089150
GI: 57921051
Clone ID: IMAGE:6326933
Tissue: egg
Stage: unfertilized egg stage
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGAGGGGATGTTTCTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTCGGCTGAGTCGATCTGGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers