Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17291709

Xenopus ORFeome
What is the ORFeome?

ORF Name:ptpn12.S ORF1 Species: laevis
Gene Symbol: ptpn12.S Entrez Gene ID: 431887
Gene Synonyms: ptp-pest, ptp-pestr
Gene Name: protein tyrosine phosphatase non-receptor type 12
Description: Protein tyrosine phosphatase
Plate: GDExl11025 Well: B12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825131
3' ORF Sequence: JZ830492
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC81122, mRNA (cDNA clone MGC:81122 IMAGE:6317444), complete cds
Template Accession: BC070582
GI: 47124686
Clone ID: ptpn12-890
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATCAAGTAGCGATCCTAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTCATTTGTGAAGGGACATC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556