Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17291913

Xenopus ORFeome

ORF Name:qki ORF2 Species: laevis
Gene Symbol: qki.S Entrez Gene ID: 734923
Gene Synonyms: qk, qk1, qki-a, qki-b, quaking, xqua
Gene Name: QKI, KH domain containing, RNA binding
Description: nucleic acid binding
Plate: GDExl11067 Well: A06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ834449
3' ORF Sequence: JZ834450
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Protein quaking-A, mRNA (cDNA clone MGC:131021 IMAGE:7979831), complete cds
Template Accession: BC108554
GI: 80477605
Clone ID: MGC:131021 IMAGE:7979831
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTTGGGGAAATGGAAACAAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGCCGGTGGCGGCTCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556